update runtime to 0.3.2, add client,server base64 tests

Author: rnro

Package.swift

@@ -89,7 +89,7 @@ let package = Package(
         // Tests-only: Runtime library linked by generated code, and also
         // helps keep the runtime library new enough to work with the generated
         // code.
-        .package(url: "https://github.com/apple/swift-openapi-runtime", .upToNextMinor(from: "0.3.1")),
+        .package(url: "https://github.com/apple/swift-openapi-runtime", .upToNextMinor(from: "0.3.2")),
 
         // Build and preview docs
         .package(url: "https://github.com/apple/swift-docc-plugin", from: "1.0.0"),

Tests/OpenAPIGeneratorReferenceTests/Resources/Docs/petstore.yaml

@@ -311,6 +311,9 @@ components:
           $ref: '#/components/schemas/PetKind'
         tag:
           type: string
+        genome:
+          type: string
+          format: byte
     Pets:
       type: array
       items:

Tests/OpenAPIGeneratorReferenceTests/Resources/ReferenceSources/Petstore/Types.swift

@@ -290,21 +290,31 @@ public enum Components {
             public var kind: Components.Schemas.PetKind?
             /// - Remark: Generated from `#/components/schemas/CreatePetRequest/tag`.
             public var tag: Swift.String?
+            /// - Remark: Generated from `#/components/schemas/CreatePetRequest/genome`.
+            public var genome: OpenAPIRuntime.Base64EncodedData?
             /// Creates a new `CreatePetRequest`.
             ///
             /// - Parameters:
             ///   - name:
             ///   - kind:
             ///   - tag:
-            public init(name: Swift.String, kind: Components.Schemas.PetKind? = nil, tag: Swift.String? = nil) {
+            ///   - genome:
+            public init(
+                name: Swift.String,
+                kind: Components.Schemas.PetKind? = nil,
+                tag: Swift.String? = nil,
+                genome: OpenAPIRuntime.Base64EncodedData? = nil
+            ) {
                 self.name = name
                 self.kind = kind
                 self.tag = tag
+                self.genome = genome
             }
             public enum CodingKeys: String, CodingKey {
                 case name
                 case kind
                 case tag
+                case genome
             }
         }
         /// - Remark: Generated from `#/components/schemas/Pets`.

Tests/PetstoreConsumerTests/Test_Client.swift

@@ -357,6 +357,87 @@ final class Test_Client: XCTestCase {
         }
     }
 
+    func testCreatePet_201_withBase64() async throws {
+        transport = .init { request, body, baseURL, operationID in
+            XCTAssertEqual(operationID, "createPet")
+            XCTAssertEqual(request.path, "/pets")
+            XCTAssertEqual(baseURL.absoluteString, "/api")
+            XCTAssertEqual(request.method, .post)
+            XCTAssertEqual(
+                request.headerFields,
+                [
+                    .accept: "application/json",
+                    .contentType: "application/json; charset=utf-8",
+                    .init("X-Extra-Arguments")!: #"{"code":1}"#,
+                ]
+            )
+            let bodyString: String
+            if let body {
+                bodyString = try await String(collecting: body, upTo: .max)
+            } else {
+                bodyString = ""
+            }
+            XCTAssertEqual(
+                bodyString,
+                #"""
+                {
+                  "genome" : "IkdBQ1RBVFRDQVRBR0FHVFRUQ0FDQ1RDQUdHQUdBR0FHQUFHVEFBR0NBVFRBR0NBR0NUR0Mi",
+                  "name" : "Fluffz"
+                }
+                """#
+            )
+            return try HTTPResponse(
+                status: .created,
+                headerFields: [
+                    .contentType: "application/json; charset=utf-8",
+                    .init("x-extra-arguments")!: #"{"code":1}"#,
+                ]
+            )
+            .withEncodedBody(
+                #"""
+                {
+                  "id": 1,
+                  "genome" : "IkdBQ1RBVFRDQVRBR0FHVFRUQ0FDQ1RDQUdHQUdBR0FHQUFHVEFBR0NBVFRBR0NBR0NUR0Mi",
+                  "name": "Fluffz"
+                }
+                """#
+            )
+        }
+        let response = try await client.createPet(
+            .init(
+                headers: .init(
+                    X_hyphen_Extra_hyphen_Arguments: .init(code: 1)
+                ),
+                body: .json(
+                    .init(
+                        name: "Fluffz",
+                        genome: Base64EncodedData(
+                            data: ArraySlice(#""GACTATTCATAGAGTTTCACCTCAGGAGAGAGAAGTAAGCATTAGCAGCTGC""#.utf8)
+                        )
+                    )
+                )
+            )
+        )
+        guard case let .created(value) = response else {
+            XCTFail("Unexpected response: \(response)")
+            return
+        }
+        XCTAssertEqual(value.headers.X_hyphen_Extra_hyphen_Arguments, .init(code: 1))
+        switch value.body {
+        case .json(let pets):
+            XCTAssertEqual(
+                pets,
+                .init(
+                    id: 1,
+                    name: "Fluffz",
+                    genome: Base64EncodedData(
+                        data: ArraySlice(#""GACTATTCATAGAGTTTCACCTCAGGAGAGAGAAGTAAGCATTAGCAGCTGC""#.utf8)
+                    )
+                )
+            )
+        }
+    }
+
     func testUpdatePet_400() async throws {
         transport = .init { request, requestBody, baseURL, operationID in
             XCTAssertEqual(operationID, "updatePet")

Tests/PetstoreConsumerTests/Test_Server.swift

@@ -293,6 +293,73 @@ final class Test_Server: XCTestCase {
         )
     }
 
+    func testCreatePet_201_withBase64() async throws {
+        client = .init(
+            createPetBlock: { input in
+                XCTAssertEqual(input.headers.X_hyphen_Extra_hyphen_Arguments, .init(code: 1))
+                guard case let .json(createPet) = input.body else {
+                    throw TestError.unexpectedValue(input.body)
+                }
+                XCTAssertEqual(
+                    createPet,
+                    .init(
+                        name: "Fluffz",
+                        genome: Base64EncodedData(
+                            data: ArraySlice(#""GACTATTCATAGAGTTTCACCTCAGGAGAGAGAAGTAAGCATTAGCAGCTGC""#.utf8)
+                        )
+                    )
+                )
+                return .created(
+                    .init(
+                        headers: .init(
+                            X_hyphen_Extra_hyphen_Arguments: .init(code: 1)
+                        ),
+                        body: .json(
+                            .init(id: 1, name: "Fluffz")
+                        )
+                    )
+                )
+            }
+        )
+        let (response, responseBody) = try await server.createPet(
+            .init(
+                soar_path: "/api/pets",
+                method: .post,
+                headerFields: [
+                    .init("x-extra-arguments")!: #"{"code":1}"#,
+                    .contentType: "application/json; charset=utf-8",
+                ]
+            ),
+            .init(
+                #"""
+                {
+
+                  "genome" : "IkdBQ1RBVFRDQVRBR0FHVFRUQ0FDQ1RDQUdHQUdBR0FHQUFHVEFBR0NBVFRBR0NBR0NUR0Mi",
+                  "name" : "Fluffz"
+                }
+                """#
+            ),
+            .init()
+        )
+        XCTAssertEqual(response.status.code, 201)
+        XCTAssertEqual(
+            response.headerFields,
+            [
+                .init("X-Extra-Arguments")!: #"{"code":1}"#,
+                .contentType: "application/json; charset=utf-8",
+            ]
+        )
+        try await XCTAssertEqualStringifiedData(
+            responseBody,
+            #"""
+            {
+              "id" : 1,
+              "name" : "Fluffz"
+            }
+            """#
+        )
+    }
+
     func testUpdatePet_204_withBody() async throws {
         client = .init(
             updatePetBlock: { input in